Library Design & Assembly

uSort-M is fully agnostic to input library composition. Any pooled DNA source can be used, including:

  • Commercial oligo pools (Twist, IDT)
  • Multiplex assembly products
  • Error-prone PCR libraries
  • Pooled site-directed mutagenesis
  • Degenerate codon libraries

Design Considerations

Library Size & Skew

The most critical factor affecting recovery efficiency is library skew—the fold-difference between the most and least abundant variants. Synthesis method determines both skew and the range of supported sequence lengths.

Method Length Max library size Skew (90/10) Delivery
Twist Oligo Pools 20–350 bp 54,000 <4× ssDNA pool
IDT oPools ≤350 bp <4× ssDNA pool
Twist Multiplexed Gene Fragments 301–500 bp 696,000 ~2× dsDNA pool
Twist Gene Pools 300–1800 bp 696,000 ~1.5× dsDNA pool
Twist Cloned Oligo Pools 1–250 bp 696,000 ~3× Cloned in vector
Twist Cloned Multiplexed Gene Fragments (Early Access) 251–450 bp 12,000 ~2× Cloned in vector

Arrayed Gene Synthesis

For one-at-a-time synthesis of full-length genes (traditional approach, or when pooled options don't meet your length or diversity requirements):

💡 Tip: Use the usortm estimate command to predict required oversampling for your library parameters before ordering synthesis.

Sequence Length

Because uSort-M leverages long read sequencing for demultiplexing, it supports highly diverse library inputs. However, because the observed rate of synthesis errors scales with sequence length, libraries containing long sequences may require deeper oversampling to achieve full coverage.

Transformation Scale

The number of transformants should exceed your library size to ensure all variants are represented. We recommend:

  • 5–10× library size for uniform libraries (low skew)
  • 10–20× library size for skewed libraries

Planning Your Experiment

Cost Estimation

Before ordering synthesis, use the usortm estimate command to calculate projected costs and coverage for your specific library parameters:

# Basic estimation for a 500-variant library
usortm estimate --library-size 500 --seq-length 300

# Custom oversampling and skew parameters
usortm estimate \
  --library-size 1000 \
  --seq-length 450 \
  --fold-sampling 6 \
  --skew 8

# Get JSON output for programmatic use
usortm estimate --library-size 500 --json

# Adjust FACS rates for your facility
usortm estimate \
  --library-size 500 \
  --machine-rate 85 \
  --operator-rate 70

The estimate command outputs:

  • Detailed cost breakdown by step (synthesis, cloning, sorting, barcoding, sequencing, hit-picking)
  • Comparison with traditional gene synthesis approaches
  • Effort metrics (time required for sorting and barcoding)
  • Expected timeline from start to finish

Experiment Planning

Create a complete experimental plan with the usortm plan command:

# Create a project directory with experiment plan
usortm plan variants.csv --output my_experiment/ \
  --seq-length 300 \
  --fold-sampling 4 \
  --skew 4

# Plan with custom parameters
usortm plan variants.csv --output large_lib/ \
  --seq-length 500 \
  --fold-sampling 8 \
  --target-coverage 0.95

The plan command generates:

  • Project directory structure
  • Plate layout files
  • Reagent preparation lists
  • Predicted coverage statistics based on simulation
  • Timeline and checkpoint schedule

File Formats

Variant Library CSV

Define your library as a CSV file with variant sequences. Two formats are supported:

Full sequence format (recommended for diverse libraries):

name,sequence
sfGFP_Y66H,ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTAACTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAA
sfGFP_F64L,ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTAACTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAA

Mutation format (for site-saturation or substitution libraries):

name,mutation
sfGFP_Y66H,Y66H
sfGFP_Y66F,Y66F
sfGFP_Y66W,Y66W
sfGFP_F64L,F64L
sfGFP_F64I,F64I

For mutation format, you must provide a reference sequence file. Mutations are specified using standard notation: WT_AA + Position + Mutant_AA (e.g., Y66H = tyrosine at position 66 mutated to histidine).

Assembly Protocol

Materials

Item Supplier Catalog #
KAPA HiFi HotStart ReadyMix Roche KK2602
DNA Clean & Concentrator Zymo D4001
NEBridge BsaI-HFv2 Golden Gate Master Mix NEB E1601S
NEB 5-alpha Competent Cells NEB C2987H

Convert ssDNA Pool to dsDNA

  1. Resuspend oligo pool to 20 ng/µL in DI water.
  2. Set up 25 µL PCR reaction.
  3. Run thermal cycle.
  4. Verify product by gel electrophoresis.
  5. Purify using DNA Clean & Concentrator.
ComponentVolume
KAPA HiFi HotStart ReadyMix (2×)12.5 µL
Oligo pool (20 ng/µL)0.5 µL
Forward primer (10 µM)0.5 µL
Reverse primer (10 µM)0.5 µL
H₂O11.0 µL
StepTempTimeCycles
Initial denaturation95 °C3 min
Denaturation98 °C20 s12×
Annealing62 °C15 s12×
Extension72 °C15 s12×
Final extension72 °C1 min

Golden Gate Assembly

  1. Set up 100 µL Golden Gate reaction.
  2. Run recommended Golden Gate program (see NEB protocol).
ComponentVolume
NEBridge BsaI-HFv2 Master Mix (2×)50 µL
Purified insert (50–100 ng)X µL
Destination vector (50–100 ng)X µL
H₂Oto 100 µL

Transformation

  1. Thaw 25 µL NEB 5-alpha cells on ice.
  2. Add 3 µL Golden Gate reaction, mix gently.
  3. Incubate on ice, 30 min.
  4. Heat shock at 42 °C, 30 s.
  5. Return to ice, 5 min.
  6. Remove 1 µL for CFU determination (see Step 4).
  7. Add remaining cells to 1 mL LB + 100 µg/mL carbenicillin (LBcarb).
  8. Incubate overnight at 37 °C with shaking.

Determine Transformation Scale

  1. Dilute the 1 µL aliquot 1:20 and 1:100 in LB + antibiotic.
  2. Plate 20 µL of each dilution on LB-agar + antibiotic.
  3. Incubate overnight at 37 °C.
  4. Count colonies to estimate total transformants.
Target: Aim to transform >10× the number of unique sequences in your library size.

Prepare Glycerol Stock

  1. Mix 500 µL overnight culture with 500 µL sterile 50% glycerol.
  2. Store at −80 °C.

Next Steps

With your transformed library in hand, proceed to FACS sorting to isolate single clones into 384-well plates.