Library Design & Assembly

uSort-M is fully agnostic to input library composition. Any pooled DNA source can be used, including:

Commercial oligo pools (Twist, IDT)
Multiplex assembly products
Error-prone PCR libraries
Pooled site-directed mutagenesis
Degenerate codon libraries

Design Considerations

Library Size & Skew

The most critical factor affecting recovery efficiency is library skew—the fold-difference between the most and least abundant variants. The choice of synthesis vendor affects both library skew and sequence length constraints.

Commercial Oligo Pool Vendors

For sequences ≤300 bp (or 30 bp inserts for substitution libraries):

IDT oPools — Excellent uniformity, typically <4-fold skew
Twist Oligo Pools — High-quality synthesis, typically <4-fold skew

Gene Fragment Vendors

For direct gene synthesis (traditional approach, or full-length genes for substitution libraries):

Twist Gene Fragments — Up to 1800 bp
IDT gBlocks — 125-3000 bp
IDT eBlocks — 300-2000 bp
Instance Bio — Cost-effective for longer genes, higher skew (10-fold or more)

💡 Tip: Use the usortm estimate command to predict required oversampling for your library parameters before ordering synthesis.

Sequence Length

Because uSort-M leverages long read sequencing for demultiplexing, it supports highly diverse library inputs. However, because the observed rate of synthesis errors scales with sequence length, libraries containing long sequences may require deeper oversampling to achieve full coverage.

Transformation Scale

The number of transformants should exceed your library size to ensure all variants are represented. We recommend:

5–10× library size for uniform libraries (low skew)
10–20× library size for skewed libraries

Planning Your Experiment

Cost Estimation

Before ordering synthesis, use the usortm estimate command to calculate projected costs and coverage for your specific library parameters:

# Basic estimation for a 500-variant library
usortm estimate --library-size 500 --seq-length 300

# Custom oversampling and skew parameters
usortm estimate \
  --library-size 1000 \
  --seq-length 450 \
  --fold-sampling 6 \
  --skew 8

# Get JSON output for programmatic use
usortm estimate --library-size 500 --json

# Adjust FACS rates for your facility
usortm estimate \
  --library-size 500 \
  --machine-rate 85 \
  --operator-rate 70

The estimate command outputs:

Detailed cost breakdown by step (synthesis, cloning, sorting, barcoding, sequencing, hit-picking)
Comparison with traditional gene synthesis approaches
Effort metrics (time required for sorting and barcoding)
Expected timeline from start to finish

Experiment Planning

Create a complete experimental plan with the usortm plan command:

# Create a project directory with experiment plan
usortm plan variants.csv --output my_experiment/ \
  --seq-length 300 \
  --fold-sampling 4 \
  --skew 4

# Plan with custom parameters
usortm plan variants.csv --output large_lib/ \
  --seq-length 500 \
  --fold-sampling 8 \
  --target-coverage 0.95

The plan command generates:

Project directory structure
Plate layout files
Reagent preparation lists
Predicted coverage statistics based on simulation
Timeline and checkpoint schedule

File Formats

Variant Library CSV

Define your library as a CSV file with variant sequences. Two formats are supported:

Full sequence format (recommended for diverse libraries):

name,sequence
sfGFP_Y66H,ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTAACTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAA
sfGFP_F64L,ATGAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCTACATACGGAAAGCTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTAACTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAAAATTCGCCACAACATTGAAGATGGATCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAA

Mutation format (for site-saturation or substitution libraries):

name,mutation
sfGFP_Y66H,Y66H
sfGFP_Y66F,Y66F
sfGFP_Y66W,Y66W
sfGFP_F64L,F64L
sfGFP_F64I,F64I

For mutation format, you must provide a reference sequence file. Mutations are specified using standard notation: WT_AA + Position + Mutant_AA (e.g., Y66H = tyrosine at position 66 mutated to histidine).

Assembly Protocol

Materials

Item	Supplier	Catalog #
KAPA HiFi HotStart ReadyMix	Roche	KK2602
DNA Clean & Concentrator	Zymo	D4001
NEBridge BsaI-HFv2 Golden Gate Master Mix	NEB	E1601S
NEB 5-alpha Competent Cells	NEB	C2987H

Step 1: Convert ssDNA Pool to dsDNA

Resuspend oligo pool to 20 ng/µL in DI water
Set up PCR reaction:
- 0.5 µL oligo pool (final conc. 0.4 ng/µL)
- 12.5 µL KAPA HiFi HotStart ReadyMix (2×)
- 0.5 µL forward primer (10 µM)
- 0.5 µL reverse primer (10 µM)
- 11 µL H₂O
Run thermal cycle:
- 95 °C, 3 min
- 12× [98 °C, 20 s; 62 °C, 15 s; 72 °C, 15 s]
- 72 °C, 1 min
Verify product by gel electrophoresis
Purify using DNA Clean & Concentrator

Step 2: Golden Gate Assembly

Set up 100 µL Golden Gate reaction:
- 50 µL NEBridge BsaI-HFv2 Master Mix (2×)
- X µL purified insert (50–100 ng)
- X µL destination vector (50–100 ng)
- H₂O to 100 µL
Run recommended Golden Gate program (see NEB protocol)

Step 3: Transformation

Thaw 25 µL NEB 5-alpha cells on ice
Add 3 µL Golden Gate reaction, mix gently
Incubate on ice, 30 min
Heat shock at 42 °C, 30 s
Return to ice, 5 min
Remove 1 µL for CFU determination (see below)
Add remaining cells to 1 mL LB + 100 µg/mL carbenicillin (LB_carb)
Incubate overnight at 37 °C with shaking

Step 4: Determine Transformation Scale

Dilute the 1 µL aliquot 1:20 and 1:100 in LB + antibiotic
Plate 20 µL of each dilution on LB-agar + antibiotic
Incubate overnight at 37 °C
Count colonies to estimate total transformants

Target: Aim to transform >10× the number of unique sequences in your library size.

Step 5: Prepare Glycerol Stock

Mix 500 µL overnight culture with 500 µL sterile 50% glycerol
Store at -80 °C

Next Steps

With your transformed library in hand, proceed to FACS sorting to isolate single clones into 384-well plates.